General Information
- Analysis ID
- OEZ005705
- Analysis Name
- mRNA profiling of COVID-19 patients
- Description
- Preliminary processing of raw reads was performed using FASTP v0.19.6 to remove adapter sequences and get obtain trimmed reads (Chen et al., 2018). The sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCA was given used as the R1 adapter sequence and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT as the R2 adapter sequence. HISAT2 v2.1 (Pertea et al., 2016) was in used for read alignment with to the human genome build 38. Samtools v1.3.1 was applied used to generate intermediate result files which are used for quality assessment of aligned reads by BamQC v2.0.0 (https://github.com/s-andrews/BamQC) and insert size distribution analysis. The aAssembly of aligned reads and assessment of expression levels are were processed through StringTie v1.3.4. Number The number of expressed genes were determined with FPKM higher than 0.5. Gene counts were obtained determined with preDE.py (http://ccb.jhu.edu/software/stringtie/) based on results derived from Ballgown (https://github.com/alyssafrazee/ballgown).
Analysis Information
- Analysis Type
- Reference Alignment
- Pipeline
Target
Analysis Data
ID | Name | Data Type | Upload Time | Comment | Security | MD5 | Download |
---|---|---|---|---|---|---|---|
OED117553 | mRNA_logFPKM_r23373c230_20200410.txt | txt | 2020-04-27 21:55:07 | Public | 9e4a3d1bd803e5f27757f62dd9a7246f |
Submitter Information
- Create Date
- 2020-04-27
- Last Modified
- 2020-04-27
- Submission
- Ying Yu