General Information
- Experiment ID
- OEX000102
- Experiment Name
- SNP Analysis_ZZ_HH
- Experiment Type
- Genomic
- Description
- single-nucleotide polymorphisms (SNPs) analysis
- Protocol
- Ear tissue sample collected from monkeys were used to extract DNA. PCR with specific primers (F: CCACTTCACATCAAACCATCACTT, R: CAAGCAGCGAATACCAGCAAAA) in mtDNA were performed. DNA was amplified with 35 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min, followed by a 5-min extension at 72℃. The PCR products were used for sequencing and the result were used for the SNP analysis.
- Used ID
- NODEX06357818  
Experiment information
- Attributes
-
library_layout Single library_name NEBNext Ultra RNA Library library_selection PCR library_strategy OTHER platform ABI PRISM 3730 - Project
-
1
Project ID Project name Create Date OEP000101 SNP and STR Analysis of "ZZ" and "HH" Generated by SCNT Using Fetal Fibroblasts 2018-02-03 - Samples
-
7
Sample ID Sample Name Organism Tissue Create Date OES002912 0523 Macaca fascicularis N/A 2018-02-03 OES002914 220 Macaca fascicularis N/A 2018-02-03 OES002913 371 Macaca fascicularis N/A 2018-02-03 OES002915 380 Macaca fascicularis N/A 2018-02-03 OES002916 516 Macaca fascicularis N/A 2018-02-03 OES002910 ZZ Macaca fascicularis N/A 2018-02-03 OES002911 HH Macaca fascicularis N/A 2018-02-03 - Runs
-
7
Run ID Run Name Sample Data Num Create Date OER009363 SNP analysis raw data of sample 0523 0523 2 2018-02-03 OER009364 SNP analysis raw data of sample #220 220 2 2018-02-03 OER009365 SNP analysis raw data of sample #371 371 2 2018-02-03 OER009366 SNP analysis raw data of sample #380 380 2 2018-02-03 OER009367 SNP analysis raw data of sample #516 516 2 2018-02-03 OER009371 SNP analysis raw data of sample ZZ ZZ 2 2018-02-03 OER009374 SNP analysis raw data of sample HH HH 2 2018-02-03
Author Information
- Create Date
- 2018-02-03
- Last Modified
- 2019-12-30
- Submission
- Sun Qiang
- the Institute of Neuroscience (ION)