General Information
- Experiment ID
- OEX000104
- Experiment Name
- SNP Analysis_Infant_A_B
- Experiment Type
- Genomic
- Description
- Single-nucleotide polymorphisms (SNPs) analysis
- Protocol
- Ear tissue sample collected from monkeys were used to extract DNA. PCR with specific primers (F: CCACTTCACATCAAACCATCACTT, R: CAAGCAGCGAATACCAGCAAAA) in mtDNA were performed. DNA was amplified with 35 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min, followed by a 5-min extension at 72℃. The PCR products were used for sequencing and the result were used for the SNP analysis.
- Used ID
- NODEX06357820  
Experiment information
- Attributes
-
library_layout Single library_selection PCR library_strategy OTHER platform ABI PRISM 3730 - Project
-
1
Project ID Project name Create Date OEP000102 Genetic Analysis of Deceased Monkeys Neonates Generated by SCNT Using Adult Cumulus Cells 2018-02-03 - Samples
-
6
Sample ID Sample Name Organism Tissue Create Date OES002921 2 Macaca fascicularis N/A 2018-02-03 OES002920 358 Macaca fascicularis N/A 2018-02-03 OES002919 497 Macaca fascicularis N/A 2018-02-03 OES002917 InfantA Macaca fascicularis N/A 2018-02-03 OES002918 InfantB Macaca fascicularis N/A 2018-02-03 OES002922 128 Macaca fascicularis N/A 2018-02-03 - Runs
-
6
Run ID Run Name Sample Data Num Create Date OER009368 SNP analysis raw data of sample #2 2 2 2018-02-03 OER009369 SNP analysis raw data of sample #358 358 2 2018-02-03 OER009370 SNP analysis raw data of sample #497 497 2 2018-02-03 OER009372 SNP analysis raw data of sample Infant A InfantA 2 2018-02-03 OER009373 SNP analysis raw data of sample Infant B InfantB 2 2018-02-03 OER009375 SNP analysis raw data of sample #128 128 2 2018-02-03
Author Information
- Create Date
- 2018-02-03
- Last Modified
- 2019-12-30
- Submission
- Sun Qiang
- the Institute of Neuroscience (ION)