General Information
- Sample ID
- OES002918
- Sample Name
- InfantB
- Description
- Deceased cloned monkey (Infant B)
- Subject type
- Animalia
- Used ID
- NODES03347318  
Sample information
- Organism
- Macaca fascicularis
- Projects
-
1
Project ID Project name Submitter Date OEP000102 Genetic Analysis of Deceased Monkeys Neonates Generated by SCNT Using Adult Cumulus Cells Qiang, Sun 2018-02-03 - Experiments
-
2
Experiment ID Experiment name Experiment type Experiment protocol Date OEX000104 SNP Analysis_Infant_A_B Genomic Ear tissue sample collected from monkeys were used to extract DNA. PCR with specific primers (F: CCACTTCACATCAAACCATCACTT, R: CAAGCAGCGAATACCAGCAAAA) in mtDNA were performed. DNA was amplified with 35 cycles of 95℃ for 30 s, 55℃ for 30 s, and 72℃ for 1 min, followed by a 5-min extension at 72℃. The PCR products were used for sequencing and the result were used for the SNP analysis. 2018-02-03 OEX000105 STR Analysis_Infant_A_B Genomic Ear tissue sample collected from monkeys were used to extract DNA. Locus-specific primers each containing a fluorescent dye (FAM/HEX/TMR) were used for PCR amplification in batches. FAM, HEX or TMR-labeled STR amplicons were diluted and mixed with internal size standard ROX500 and deionized formamide, followed by capillary electrophoresis on ABI PRISM 3730 genetic analyzer to obtain the raw data. 2018-02-03 - Runs
- 2
- Analysis
-
1
Analysis ID Analysis Title Analysis Type Data Date OEZ000378 STR Analysis result of Infant B Other 0 2018-02-03
Author Information
- Create Date
- 2018-02-03
- Submission
- Sun Qiang,the Institute of Neuroscience (ION)