General Information
- Analysis ID
- OEZ005704
- Analysis Name
- exRNA profiling of COVID-19 patients
- Description
- The libraries were sequenced in two batches, with an average sequencing depth of 15.7M raw reads per library. All FASTQ files were delivered to the ExceRpt small RNA sequencing data analysis pipeline (Rozowsky et al., 2019)(docker v4.6.3). Default parameters were used with exception of: (i) the sequence TGGAATTCTCGGGTGCCAAGG was given as the 3’adapter seq, ignoring the adapter sequences guessed by the pipeline; (ii) the random barcode length was set to 4; (iii) the priority of the reference libraries during read assignment were set to miRNA > piRNA > tRNA > gencode > circRNA (Godoy et al., 2018). Pre-compiled genome and transcriptome indices of hg38 were used. The raw read count matrix was then normalized using count per million (CPM).
Analysis Information
- Analysis Type
- Reference Alignment
- Pipeline
Target
Analysis Data
ID | Name | Data Type | Upload Time | Comment | Security | MD5 | Download |
---|---|---|---|---|---|---|---|
OED117557 | exprMat_exRNA_CPM_769r125c_0427.csv | csv | 2020-04-27 21:54:59 | Public | 4a5598808cec3fd50751c650620b7be2 |
Submitter Information
- Create Date
- 2020-04-27
- Last Modified
- 2020-04-27
- Submission
- Ying Yu