Abstract: | Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 μm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc. |